Number Tracker
India Phone Number Location Tracker

+91

Number Search: 1

Mobile Number Location of 79653787


Number 79653787
Operator
Number Type Landline
Whatsapp Details 79653787
Location Ahmedabad
Detailed Location Ahmedabad India
Country Code +91
International Format +9179653787
City/State (HLR*) Colu*****
Only after 9 more mobile number Search.
City (HLR*) Colu*****
Search 9 more numbers to unlock.
Coordinates (HLR*) Search 9 more numbers to unlock.
Phone Number Location of 79653787

Ahmedabad India

Phone Number 79653787 location is found around Ahmedabad, India. This Phone Number 79653787 is being operated by . Phone number 79653787 is a landline number.

Web Results: 79653787


Wintech 8 mm 2 Flutes Solid Carbide Long Shank Ballnose End Mill ...

79653787. Flute Length. 12 mm. Helix Angle. 30°. No. of Flutes. 2 Flute. Shank Diameter. 8 mm. Coating. TiAlCrSiN Coating. Cutting diameter. 8 mm. Series. SH260 ...

Happy Dodo Walking Stock Illustration 79653787 | Shutterstock

Funny cartoon character vulture babi isolated on a white background. 3d figure, clip art. 79653787.

Orange Brick Wall Background Stock Image - Dreamstime.com

Photo about Orange brick wall background and texture. Image of construction, backgrounds, texture - 79653787.

Happy Dodo Walking Stock-illustration 79653787 - Shutterstock

Funny cartoon character vulture babi isolated on a white background. 3d figure, clip art. 79653787. Beskrivelse ...

Sushila (s79653787) - Profile | Pinterest

s79653787. ·. 0 followers. ·. 0 following. Follow. s79653787 hasn't saved any Pins yet.

changes in flower size and number under heat stress in rose (rosa ...

Shapiro-Wilk W testz. Population. DM log10 DM. PT log10 PT DW log10 DW. OB × M4-4. NS. NS. *. NS. *. NS. SC × M4-4. NS. NS. NS. NS. *. *. J14-3 × VS.

Buy womens Boot Socks Online at desertcartINDIA

Machine Wash. 100 percent polyester. Made in china. Machine washable. Similar Products. 28731437 · 20529168 · 79653787 · 42526193 · 207197653 · 63016271 ...

World Cup Finals, Azteca Stadium, Mexico, 31st May Opening ...

79653787. Collection: Bob Thomas Sports Photography. Date created: May 31, 1986. Upload date: February 08, 2008. License type: Rights-managed.

Casaco Moletom Zara Babyboy | Zara Usado 79653787 - Enjoei

Compre Zara Usado no enjoei casaco moletom zara babyboy tamanho: 18/24 meses seminova. Código: 79653787.

cd2ap ORF1 – XORFeome v1.0

79653787. Trimmed Sequence: Full Trace Sequence: Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTAACTGGACCGCCTTCT. Slide. Xenopus are a schedule 2 species ...

India

Country in South AsiaIndia

India, officially the Republic of India, is a country in South Asia. It is the seventh-largest country by area; the most populous country as of June 2023; and from the time of its independence in 1947, the world's most populous democracy.

Ahmedabad

City in India https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcSzWMvOEkh8fNwCXTEcp6_YfvUsZ8wve1sarovxA2xHPSZfhhSn

Ahmedabad is the most populous city in the Indian state of Gujarat. It is the administrative headquarters of the Ahmedabad district and the seat of the Gujarat High Court.

Ahmedabad - INDIA

India

Country in South Asia https://encrypted-tbn3.gstatic.com/images?q=tbn:ANd9GcRJntVqlX9v33wp6-prjbYtrLFMS1ikTtgh5xgm2mJ6hQVg95rX

India, officially the Republic of India, is a country in South Asia. It is the seventh-largest country by area; the most populous country from June 2023 and from the time of its independence in 1947, the world's most populous democracy.

Air India

Airline https://encrypted-tbn2.gstatic.com/images?q=tbn:ANd9GcRWEt1BC3Hdl8cMAI7eQ1v6Hg1eP2ki_Cu69T1C93x2IGiWi4_s

Air India is the flag carrier airline of India. It is owned by Air India Limited, a Tata Group enterprise and operates a fleet of Airbus and Boeing aircraft serving 102 domestic and international destinations. It is headquartered in Gurugram.

Axis Bank

Banking company https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcRK-6Z6nDuNcbCkIoMsiiC425GzComZSYXt1wuOgBb1Cxr80Kh2

Axis Bank Limited, formerly known as UTI Bank, is an Indian multinational banking and financial services company headquartered in Mumbai, Maharashtra. It is India's third largest private sector bank by assets and fourth largest by market capitalisation. It sells financial services to large and mid-size companies, SMEs and retail businesses. As of 30 June 2016, 30.81% shares are owned by the promoters and the promoter group.

IndiaMART

E-marketing company

IndiaMART InterMESH Ltd is India's largest B2B online marketplace, connecting buyers and suppliers. It is headquartered in Noida and currently hosts 194 million registered buyers and 7.9 million sellers, listed on its marketplace.

Trace Mobile Number Location

NumberTrackr

NumberTrackr.com is the place to trace any mobile number in the most sophisticated way. Our mobile number tracker, based on the always updating algorithm and the latest technology can show details like name, location of the number, network operator name, and the regional information of the number in seconds. Our service does not stop there, as our search results also include if the mobile number is active and the registered complaints, if any. Our mobile number tracking tool is free to use and it works throughout the country. Do note that, we do not collect any data from the user and we just use this window to show already available information on the internet, making it private and safe.

How to trace the mobile number?

Want to trace an unknown mobile number, just enter the mobile number that you are interested in tracking or locating and we will do the rest of the jobs to get all the information related to the phone number. Though it might sound like a lot, we have made this process very simple and easy, where anyone can trace a mobile number with ease.

What is HLR (home location register)?*

Whenever a mobile device makes a connection with a mobile network a Message Switching Center (MSC) will access the network providers HLR and use their International Mobile Subscriber Identity (IMSI) code to check what services the subscriber is allowed to access as part of their contract.
NumberTracr’s HLR service is called Number Lookup.

Last 10 Mobile Trace Requests...

Mobile No Country Date Time Operator Location
823534**** IN 2024-10-19 23:04:25 Tata Teleservices Ltd (TTSL) Bihar
836082**** IN 2024-10-19 23:04:22 Reliance Jio Infocomm Ltd (RJIL) Punjab
727859**** IN 2024-10-19 23:03:58 Aircel Cellular Ltd Kolkata
811627**** IN 2024-10-19 23:03:57 Bharti Airtel Ltd West Bengal
939925**** IN 2024-10-19 23:03:55 Reliance Communications Ltd (RCOM) Andhra Pradesh
915761**** IN 2024-10-19 23:03:47 Telenor (India) Communications Pvt. Ltd Gujarat
934796**** IN 2024-10-19 23:03:17 Reliance Jio Infocomm Ltd (RJIL) Andhra Pradesh
814676**** IN 2024-10-19 23:03:10 Bharti Airtel Ltd Punjab
923612**** IN 2024-10-19 23:03:07 Reliance Jio Infocomm Ltd (RJIL) Uttar Pradesh (East)
999662**** IN 2024-10-19 23:03:03 Bharti Airtel Ltd Haryana