Number Tracker
Bangladesh Phone Number Location Tracker

+880

Number Search: 1

Mobile Number Location of 1317381679


Number 1317381679
Operator GrameenPhone Ltd (GP)
Number Type Mobile
Whatsapp Details 1317381679
Location
Detailed Location Bangladesh (People's Republic of)
Country Code +880
International Format +8801317381679
City/State (HLR*) Colu*****
Only after 9 more mobile number Search.
City (HLR*) Colu*****
Search 9 more numbers to unlock.
Coordinates (HLR*) Search 9 more numbers to unlock.
Phone Number Location of 1317381679

Bangladesh (People's Republic of)

Phone Number 1317381679 location is found around , Bangladesh (People's Republic of). This Phone Number 1317381679 is being operated by GrameenPhone Ltd (GP). Phone number 1317381679 is a mobile number.

Web Results: 1317381679


Gender and Climate Change Impacts, Science, Policy | Rent ...

Rent Gender and Climate Change 1st edition (978-1317381679) today, or search our site for other textbooks by Joane Nagel. Every textbook comes with a ...

Alignment for AC090244.17 and AC007922.13 - dbGaP

... 13 <1738 ............................................................ 1679 AC090244.17 <79910 gatttgtcctgaacatgatttgtcaaagattgttttatagaaacatcctcaatatttatt ...

ASLI! 085714808586,JASA RENOVASI DI Kel. Curug ,Kec ...

ASLI! 085714808586,JASA RENOVASI DI Kel. Curug ,Kec. Cimanggis, Kota Depok [Bp Ali] KONTRAKTOR AMANAH, PROFESIONAL, TERPERCAYA, WA 0857 1480 8586, ...

Bangladesh

Country in South AsiaBangladesh

Bangladesh, officially the People's Republic of Bangladesh, is a country in South Asia. It is the eighth-most populous country in the world and is among the most densely populated countries with a population of nearly 170 million in an area of 148,460 square kilometres.

Bangladesh

Country in South Asia https://encrypted-tbn1.gstatic.com/images?q=tbn:ANd9GcQzF6CN_fQMb2QOiLQ1aH_xcW1kkjuS66nPysDBqc_7lxZsmkKU

Bangladesh, officially the People's Republic of Bangladesh, is a country in South Asia. It is the eighth-most populous country in the world and among the most densely populated with a population of 170 million in an area of 148,460 square kilometres.

Bangladesh national cricket team

Cricket team https://encrypted-tbn1.gstatic.com/images?q=tbn:ANd9GcRImYHJoGNsuHuQh1mNj8MMNY0bpxeNCjVRO4FhEOdIJBe3F_G_

The Bangladesh men's national cricket team, popularly known as The Tigers, is administered by the Bangladesh Cricket Board. It is a Full Member of the International Cricket Council with Test, One-Day International and Twenty20 International status.

Bangladesh national football team

Football team

The Bangladesh national football team is the national recognised football team of Bangladesh and is controlled by the Bangladesh Football Federation.

Bangladesh Railway

Rail transport company https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcRpcifg3o3sluuEtnSA6QHn6xYn42HDB-2XQ2LDz5iw8bY9xnb8

Bangladesh Railway is the state-owned rail transport agency of Bangladesh. It operates and maintains all railways in the country, and is overseen by the Directorate General of Bangladesh Railway.

Bangladesh Bank

Central bank https://encrypted-tbn2.gstatic.com/images?q=tbn:ANd9GcTYerEKR_iEvBU5O5fwVf1dJJ8cP3nrJltKnFJmJqbS_uHmEMd4

Bangladesh Bank is the central bank of Bangladesh and is a member of the Asian Clearing Union. It is fully owned by the Government of Bangladesh.

Prime Minister of Bangladesh

https://encrypted-tbn2.gstatic.com/images?q=tbn:ANd9GcS5LDkLPiiAPVdo9Q6XfwzmNU0ODdkKDTMy47QAjmY9AsbfBy57

The Prime Minister of Bangladesh, officially prime minister of the People's Republic of Bangladesh, is the chief executive of the government of Bangladesh.

Trace Mobile Number Location

NumberTrackr

NumberTrackr.com is the place to trace any mobile number in the most sophisticated way. Our mobile number tracker, based on the always updating algorithm and the latest technology can show details like name, location of the number, network operator name, and the regional information of the number in seconds. Our service does not stop there, as our search results also include if the mobile number is active and the registered complaints, if any. Our mobile number tracking tool is free to use and it works throughout the country. Do note that, we do not collect any data from the user and we just use this window to show already available information on the internet, making it private and safe.

How to trace the mobile number?

Want to trace an unknown mobile number, just enter the mobile number that you are interested in tracking or locating and we will do the rest of the jobs to get all the information related to the phone number. Though it might sound like a lot, we have made this process very simple and easy, where anyone can trace a mobile number with ease.

What is HLR (home location register)?*

Whenever a mobile device makes a connection with a mobile network a Message Switching Center (MSC) will access the network providers HLR and use their International Mobile Subscriber Identity (IMSI) code to check what services the subscriber is allowed to access as part of their contract.
NumberTracr’s HLR service is called Number Lookup.

Last 10 Mobile Trace Requests...

Mobile No Country Date Time Operator Location
161889**** BD 2024-09-30 20:50:22 Robi Axiata Ltd
183328**** BD 2024-09-30 20:47:46 Robi Axiata Ltd
133430**** BD 2024-09-30 20:44:39 GrameenPhone Ltd (GP)
152177**** BD 2024-09-30 20:42:19 Teletalk Bangladesh Ltd
199296**** BD 2024-09-30 20:41:32 Banglalink Digital Communications Ltd
161635**** BD 2024-09-30 20:37:58 Robi Axiata Ltd
183550**** BD 2024-09-30 20:35:58 Robi Axiata Ltd
161188**** BD 2024-09-30 20:35:42 Robi Axiata Ltd
175630**** BD 2024-09-30 20:33:44 GrameenPhone Ltd (GP)
190725**** BD 2024-09-30 20:32:32 Banglalink Digital Communications Ltd